DNA replication is not correct? (a) Unwinding of DNA molecule occurs as hydrogen bonds break. (b) Replication occurs as each base is paired with another exactly like it. (c) Process is known as semi conservative replication because one old strand is conserved in the new molecule.
(d) Complementary base pairs are held together with hydrogen bonds. . Which of the following statements is not true about DNA replication in eukaryotes? XII Std Biology-Zoology Chapter- XII Std Biology-Zoology Chapter- Molecular Genetics .
Why tRNA is called an adapter molecule? . What are the three structural differences between RNA and DNA? .
Name the anticodon required to recognize the following codons: AAU, CGA, UAU, and GCA. . a) Identify the figure given below: b) Redraw the structure as a replicating fork and label the parts. c) Write the source of energy for this replication and name the enzyme involved in this process.
d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands. . If the coding sequence in a transcription unit is written as follows: ' TGCATGCATGCATGCATGCATGCATGC ' Write down the sequence of mRNA. .
How is the two stage process of protein synthesis advantageous? .Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen? .
Explain the formation of a nucleosome. . It is established that RNA is the first genetic material. Justify giving reasons.
' ' ' ' . Give reasons: Genetic code is ‘universal’. . Name the parts marked ‘A’ and ‘B’ in the given transcription unit: A B ’ ’ ’ ’ .
Differentiate - Leading stand and lagging strand . Differentiate - Template strand and coding strand. . Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.
. State any three goals of the human genome project. . In E.coli , three enzymes β- galactosidase, permease and transacetylase are produced